Галимова Д.Н., Попович Д., Панагиотополо Х., Аськеев И.В., Аськеев О.В. Предварительные результаты исследования исторической ДНК костных остатков рыб из археологических памятников

PRELIMINARY RESULTS OF ANCIENT DNA OF FISH REMAINS

FROM ARCHAEOLOGICAL SITES

ABSTRACT: In this article is considered research of the ancient DNA from subfossil bones of fishe remains from medieval archaeological sites (Tetyushsky II hillfort, Muromsky gorodok, Toretsky settlement) from Middle Volga region and the Leningrad region (Staraja Ladoga), Russia. Similar researches from this territory are conducted for the first time. For this purpose within the joint research on the sturgeon evolution and phylogeography in May, 2012 in biomontoring laboratory of Institute of Problems in Ecology and Mineral Wealth was gettering subfossil bones of 11 fish species belonging to 3 families: sturgeon, whitefish, perch for molecular genetic studies. Preliminary results of mtDNA for 30 samples of fish bones, morphologically identified as Acipenser oxyrinchus, Acipenser sturio, Acipenser sturio х A.oxyrinchus, Acipenser sturio/A.oxyrinchus, Sander lucioperca and Sander volgensis are received (table 1). All works with aDNA were performed in the Institute of Genetics and Biotechnology, University of Warsaw. Taxonomical identification of the subfossil remains were based on the mtDNA sequence. In case of sturgeon samples we amplified and sequenced 160bp of 5’end of the control region using primers HETERO 1 and HETERO2 (Ludwig and Jenneckens 2000). In case of perch we analyzed 160 bp of cytochrome b gene. Amplification and sequencing were performed using primers primersSanCyt1f (TTGCCGAGACGTAAATTATGG), SanCyt2R (GCGGTCATTATAACTAAAAGAAGTAGG) which we designed using PRIMER3 (Rozen & Skaletsky, 2000). Seven of 15 perch specimens yielded DNA suitable for amplification and sequencing allowing species identification. The obtained sequences for six samples were monomorphic and identical with Sander lucioperca sequence deposed in GenBank (accession number HM049965). One specimen was found to be Stizostedion volgense and differing from GenBank sequence (accession number AY374292) by two transitions. All analyzed sturgeon samples were successfully identified based on the DNA sequences. 15 of them appeared to beidentical with the sequence obtained for A. oxyrinchus species (accession numbers in GenBank AF162716) also known as haplotype A (Ong, 1996). This haplotype is typical for the ancient Baltic sturgeon population and dominant one in contemporary population of A. oxyrinchus in Canadian rivers. Only one specimen possessed sequence characteristic for A. sturio (accession number in GenBank AJ249673). This haplotype was also found in the ancient population of Baltic sturgeon and is the only one left in Garonne river system in France (Stankovic, 2011). These results, according to our knowledge, present the first evidence of appearance of A. oxyrinchus in Staraja Ladoga and so far to the east of Europe. Further analysis of nuclear DNA will be performed to investigate potential hybridization between these two sturgeon species.

This work was carried out with the support of the project financing agreements POIG.02.02.00-14-024/08-00, through grant N N304 174140 (the Polish Ministry of Science and Higher Education) with use of CePT infrastructure financed by the EU and financial support of the administration of The Institute of Problems in Ecology and Mineral Wealth, Tatarstan Academy of Sciences.

 

Обширное развитие молекулярных методов за последние 30 лет дало возможность исследованию ДНК, которая была выделена из мумифицированных образцов ткани, археологических и музейных материалов, а также образцов, извлеченных из льда и вечной мерзлоты. Эта, так называемая «древняя» или «историческая» ДНК, как правило, подвержена сильной деградации в результате окисления, ультрафиолетового и радиационного излучения, а также воздействия эндо/экзогенных нуклеаз при пищеварительных процессах (Hofreiter 2001; Paabo et al, 2004). Уровень деградации «исторической» ДНК зависит от тафономических условий захоронения, условий и методов хранения их после изъятия из местонахождения. Анализ «исторической» ДНК, извлеченной из остатков вымерших животных помогает установить их филогенетические связи с современными родственниками и определить основные процессы, ответственные за генетическое разнообразие современной популяции. Это особенно важно для видов, находящихся под угрозой исчезновения, где соответствующие усилия по сохранению этих видов могут быть основаны на сравнении генетической изменчивости в прошлом и настоящем (Hofreiter et al, 2001; Paabo et al, 2004; Wandeler et al, 2007). Целый ряд недавних крупномасштабных исследований ДНК «древних» образцов показал их истинный потенциал и возможность использования тестовых моделей, построенных на основе анализа ДНК «древних» образцов,

118

которые используются для изучения процессов и закономерностей эволюции и анализа популяционной генетики и палеоэкологических изменений (Rizzi et al, 2012).

Исследование «исторической» ДНК различных групп животных из археологических памятников на сегодняшний день является новым, передовым и перспективным методом, применяемым в археозоологии, который позволяет установить таксономическую принадлежность костных остатков, уточнить морфологические разграничения при таксономическом определении костей, выявить уровень гибридизации между исследуемыми видами, установить гаплотип особей, филогенетическую структуру и связи в популяциях животных, обитавших и обитающих на исследуемой территории.

Исследования «исторической» ДНК субфоссильных костных остатков рыб из археологических памятников с территории Среднего Поволжья и Ленинградской области проводятся впервые. С этой целью в рамках программы по изучению эволюции и филогеографии осетровых рыб в мае 2012 г. сотрудниками Центра Новых Технологий Варшавского Университета, Института Биохимии и Биофизики ПАН и сотрудниками лаборатории биомонторинга Института проблем экологии и недропользования АН РТ был осуществлен отбор субфоссильных костных остатков 11 видов рыб, принадлежащих 3 семействам: осетровые, сиговые, окуневые. Кости рыб происходят из раскопок 4 археологических памятников:

1) Старая Ладога (нач. VIII – X вв. н.э., Ленинградская область, РФ). Всего было отобрано 102 экз. костных остатков осетровых, морфологически идентифицированных как Acipenser oxyrinchus – 80 костей: dorsal scutae (13 экз.), lateral scutae (23 экз.), ventral scutae (18 экз.), покровные кости neurocranium (10 экз.), suboperculare (4 экз.), cleithrum (2 экз.), supracleithrale (3 экз.), dentale (1 экз.), maxillare (1 экз.), palato-pterygoideum (1 экз.), pinna pectorali I (3 экз.), branchialia I (1 экз.); Acipenser sturio – 10 костей: dorsal scutae (2 экз.), lateral scutae (1 экз.), ventral scutae (1 экз.), покровные кости neurocranium (2 экз.), frontale (1 экз.), parietale (1 экз.), maxillare (1 экз.), palato-pterygoideum (1 экз.); возможный гибрид Acipenser oxyrinchus х Acipenser sturio – 7 костей: dorsal scutae (2 экз.), lateral scutae (2 экз.), ventral scutae (1 экз.), maxillare (1 экз.), palato-pterygoideum (1 экз.); кости, которые не удалось точно морфологически определить до вида, обозначенные Acipenser oxyrinchus/ Acipenser sturio – 2 кости: покровные кости neurocranium (1 экз.), pinna pectorali I (1 экз.), Acipenser oxyrinchus? – 1 кость: ventral scutae, Acipenser sturio? – 2 кости: dorsal scutae, покровная кость neurocranium; и 5 костей (praeoperculare, dentale – 2 экз., palatinum, praemaxillare), морфологически определяемых как обыкновенный судак Sander lucioperca.

2) Тетюшское II городище (V-VII вв. н.э., г. Тетюши, Республика Татарстан, РФ). Всего было отобрано 9 экз. костных остатков осетровых, морфологически идентифицированных как русский осетр (Acipenser gueldenstaedtii) – 2 кости: ventral scutae, pinna pectorali I; стерлядь (Acipenser ruthenus) – 3 кости: clavicula, pinna pectoralis I (2 экз.); севрюга (Acipenser stellatus) – 2 кости: dorsal scutae, suboperculare; белуга (Huso huso) – 2 кости: dentale, suboperculare; 2 кости белорыбицы (сем. сиговые) (Stenodus leucichthus leucichthus) – hyomandibulare, vertebrae; 2 кости обыкновенного судака (Sander lucioperca) – vertebrae и 1 кость берша (Sander volgensis) – dentale.

3) Муромский городок (X – XII вв. н.э., Самарская область, РФ). Всего было отобрано 6 экз. костных остатков осетровых, морфологически идентифицированных как русский осетр (Acipenser gueldenstaedtii) – 2 кости: ventral scutae, pinna pectorali I; стерлядь (Acipenser ruthenus) – 2 кости: pinna pectorali I; белуга (Huso huso) – 2 кости: maxillare, dentale; и 5 костей обыкновенного судака (Sander lucioperca) – vertebrae.

4) Торецкое поселение (XV в. н.э., Алексеевский район, Республика Татарстан, РФ). Всего было отобрано 4 экз. костных остатков осетровых, морфологически идентифицированных как русский осетр (Acipenser gueldenstaedtii) – 1 кость: pinna pectorali I; стерлядь (Acipenser ruthenus) – 2 кости: pinna pectoralis I; белуга (Huso huso) – 1 кость: dentale; 1 кость белорыбицы (Stenodus leucichthus leucichthus) – hyomandibulare; и 2 кости обыкновенного судака (Sander lucioperca) – vertebra.

Отобранные образцы костей были отправлены в лабораторию «исторической» ДНК Института генетики и биотехнологий Варшавского Университета с целью проведения молекулярно–генетических исследований. Отбор образцов производился на основе сохранности кости и ее теоретической пригодности для выделения и анализа ДНК (определяется визуальным и органолептическим методом). Были отобраны различные элементы скелета хорошей сохранности, твердые на ощупь, с цельной поверхностной структурой, не рассыпающиеся при малом физическом воздействии.

На сегодняшний день проанализирована ДНК, извлеченная из 15 образцов костей осетровых рыб, морфологически определяемых как виды Acipenser oxyrinchus, Acipenser sturio, возможный гибрид Acipenser oxyrinchus х Acipenser sturio и кости, которые не удалось точно морфологически определить до вида, обозначенные как Acipenser oxyrinchus/Acipenser sturio из раскопок археологического памятника Старая Ладога, и 15 образцов костных остатков окуневых рыб, морфологически определяемых как виды Sander lucioperca и Sander volgensis из раскопок археологических памятников Старая Ладога, Муромский городок, Торецкое поселение и Тетюшское II городище (таб. 1). Анализ ДНК остальных образцов будет произведен позднее.

119

Таблица 1. Список проанализированных образцов.

Виды (на основе морфологической идентификация)

Элементы скелета

Номер образца (ID)

Виды (на основе секвенирования мтДНК)

Старая Ладога (нач. VIII – X вв.), Ленинградская область, РФ - раскопки 2010 г.

Sander lucioperca

dentale, dex

S1

не удалось амплифицировать

Sander lucioperca

dentale, dex

S2

Sander lucioperca

Sander lucioperca

palatinum, dex

S3

Sander lucioperca

Sander lucioperca

praeoperculare, dex

S4

Sander lucioperca

Sander lucioperca

praemaxillare, sin

S5

Sander lucioperca

Тетюшское II городище (V-VII вв.), г. Тетюши,

Республика Татарстат, РФ – раскопки 2010 г.

Sander lucioperca

vertebrae

S6

не удалось амплифицировать

Sander lucioperca

vertebrae

S7

Sander lucioperca

Sander volgensis

dentale, sin

S8

Stizostedion volgense

Торецкое поселение (XV в.), Алексеевский район,

Республика Татарстан, РФ – раскопки 2010 г.

Sander lucioperca

vertebrae

S9

не удалось амплифицировать

Sander lucioperca

vertebrae

S10

не удалось амплифицировать

Муромский городок (X – XII вв.), Самарская область, РФ – раскопки 2005 г.

Sander lucioperca

vertebrae

S11

не удалось амплифицировать

Sander lucioperca

vertebrae

S12

Sander lucioperca

Sander lucioperca

vertebrae

S13

не удалось

амплифицировать

Sander lucioperca

vertebrae

S14

не удалось амплифицировать

Sander lucioperca

vertebrae

S15

не удалось амплифицировать

Старая Ладога (нач. VIII – X вв.), Ленинградская область, РФ - раскопки 2004 г.

Acipenser sturio

ventral scute

S-84_2

A. oxyrinchus

Старая Ладога (нач. VIII – X вв.), Ленинградская область, РФ - раскопки 2008 г.

Acipenser sturio/ A.oxyrinchus

lateralscute

S_66_7

A. oxyrinchus

Старая Ладога (нач. VIII – X вв.), Ленинградская область, РФ - раскопки 2009 г.

Acipenser oxyrinchus

neurocranium

S_28_9

A. oxyrinchus

Acipenser oxyrinchus

neurocranium

S_32_11

A. oxyrinchus

Старая Ладога (нач. VIII – X вв.), Ленинградская область, РФ - раскопки 2010 г.

Acipenser oxyrinchus

dorsal scute

S_39_1

A. oxyrinchus

Acipenser sturio

palato-pterygoideum

S_7_3

A. oxyrinchus

Acipenser oxyrinchus

ventral scute

S_18_4

A. oxyrinchus

Acipenser sturio х A.oxyrinchus

dorsal scute

S_8_5

A. oxyrinchus

Acipenser oxyrinchus

suboperculare, sin

S_10_6

A. oxyrinchus

A. sturio/A.oxyrinchus

pinna pectoralis I, dex

S_24_8

A. oxyrinchus

Acipenser oxyrinchus

branchialia I, sin

S_5_10

A. oxyrinchus

Acipenser oxyrinchus

ventra lscute

S_4_12

A. oxyrinchus

Acipenser oxyrinchus

lateral scute

S_9_13

A. oxyrinchus

Acipenser oxyrinchus

supracleithrale

S_19_14

A. oxyrinchus

Acipenser sturio

maxillare sin

S_1_15

A. sturio

120

Все работы с «исторической» ДНК проводились в специальных боксах с ламинарным освещением в стерильной комнате, предназначенной для анализа «исторической» ДНК. В данной комнате так же проводится обработка УФ лучами в перерывах между работой. Во избежание загрязнения все работы в этой комнате были проведены в защитной одежде, масках и двойных перчатках. Первым этапом исследования была подготовка материала для экстракции ДНК. Для удаления загрязнений и чужеродной ДНК с поверхности кости каждый образец очищался с помощью скальпеля и наждачной бумаги, затем промывался в хлоре, спирте и дважды стерильной дистиллированной воде. Затем очищенные образцы закладывались в специальные пробирки и помещались в морозильную камеру 6750 Freezer/Mill (Centrispex) для измельчения костей до консистенции пылеобразного вещества. После измельчения в полученные 500-750 мг вещества (каждый образец) добавляли 1,6 мл экстракционного буфера (0.1 M EDTA, pH 8.0, 20 mM DTT, 0.5% N-laurylsarcosine, 5 mM PTB, 30 μl Proteinase K (20 μg/ml)), и оставляли образцы на ночь для осуществления ферментативной реакции. После ночной ферментативной реакции ДНК была выделена двумя различными способами. Первый способ включают в себя использование модифицированного экстракта фенол-хлороформа (Sambrook et al. 1989) и осадка 95% изопропанола, содержащего Pink Precipitation Enhancer (Bioline). Гранулы ДНК были ресуспензированы (повторно приостановлены) в 30 μl буфера ТЕ. Другой способ заключается в использовании системы Maxwell ® 16 Forensic Instrument System (Promega) и экстракция выполнялась с использованием комплекса DNA IQ™ Casework Pro Kit for Maxwell® 16 (Promega) согласно протоколу изготовления.

Таксономическая идентификация субфоссильных остатков была основана на последовательности митохондриальной ДНК (мтДНК). ДНК осетровых рыб была амплифицирована и секвенирована по 160 bp контрольного региона с 5'-конца с использованием праймера HETERO 1 и HETERO2 (Ludwig, Jenneckens 2000). ДНК окуневых рыб была проанализирована по 160 bp контрольному региону на основании гена цитохром b. Амплификация и секвенирование было проведено с использованием праймеров primers SanCyt1f (TTGCCGAGACGTAAATTATGG), SanCyt2R (GCGGTCATTATAACTAAAAGAAGTAGG), которые были разработаны с использованием PRIMER3 (Rozen&Skaletsky, 2000). Условия амплификации для обоих генов были следующие: начальная денатурация 5 минут при 95°C, 40 циклов по 30 секунд при 94°C, 25 секунд при 52°C, 25 секунд при 72°C, и заключительный шаг - экстракции 5 минут при 72°C. Секвенирование и анализ продуктов ПЦР выполнялись службой Oligo.pl (Oligo, IBB, Варшава, Польша) на автоматизированных секвенаторах ABI PRISM 377 и 310 (Applied Biosystems), сшивание производилось с помощью программного обеспечения Bioedit v. 7.0.5.3 (Hall, 1999). Базовые последовательности построены на основе последовательностей, полученных из двух параллельных изоляций и ПЦР реакций.

Только 7 из 15 образцов выделенной ДНК сем. окуневых удалось амплифицировать и секвенировать. Полученные последовательности 6 образцов были мономорфны и идентичны последовательности обыкновенного судака Sander lucioperca, утвержденной в GenBank (инвентарный номер HM049965). Один образец был идентифицирован как берш Stizostedion volgense (инвентарный номер в GenBank AY374292) и отличается от последовательности обыкновенного судака по двум позициям. На основе полученных данных, можно сделать вывод о правильности подбора критериев при морфологическом определении костных остатков Sander lucioperca и Sander volgensis и возможности использования праймера Sander lucioperca для генетической идентификации Sander volgensis. Экстрагированную ДНК остальных 8 костей Sander lucioperca амплифицировать не удалось, что может быть связано с влиянием особенностей способов обработки рыбы средневековым населением (например, варки перед употреблением в пищу), процессов разложения органического вещества и тафономии, что могло привести к деградации ДНК.

         Экстрагированная ДНК 15 образцов осетровых была успешно амплифицирована и секвенирована. Из 15 образцов осетровых рыб (Старая Ладога) 14 оказались идентичны генетической последовательности, принадлежащей виду Acipenser oxyrinchus (инвентарные номера в GenBank AF162716), также известной как гаплотип (Ong, 1996). Этот гаплотип типичен для древней Балтийской популяции осетров и доминирует в современной популяции A. oxyrinchus в канадских реках. И только один образец обладает характеристикой последовательности вида А.sturio (инвентарный номер в GenBank AJ249673). Этот гаплотип был также найден в древней популяции Балтийского осетра и является единственным, сохранившемся в настоящее время в системе реки Гаронны во Франции (Stankovic, 2011). Эти результаты, согласно нашим знаниям, представляют первые доказательства появления A. oxyrinchus в Старой Ладоге и распространения данного вида дальше на восток Европы.

Согласно полученным результатам, выявлены следующие совпадения «морфологическая идентификация – генетическая идентификация (мтДНК)» проанализированных образцов осетровых рыб из археологического памятника Старая Ладога: для Acipenser oxyrinchus совпали все 9 образцов, для А.sturio из 3 образцов совпал только 1 образец (остальные 2 образца генетически определены как Acipenser oxyrinchus); кости, морфологически определенные как Acipenser sturio х A.oxyrinchus и A. sturio/A.oxyrinchus согласно мтДНК принадлежат Acipenser oxyrinchus (таблица 1). Процент совпадения морфологической и генетической идентификации составил 66,6%, что говорит о действительной возможности разграничения видов Acipenser oxyrinchus и Acipenser sturio при морфологическом определении их костных остатков из археологических памятников и правильном подборе критериев этого разграничения.

Дальнейший анализ ядерной ДНК будет осуществляться в рамках исследования потенциала гибридизации между этими двумя видами осетровых рыб.

121

Работа выполнена при поддержке проекта соглашения о финансировании POIG.02.02.00-14-024/08-00, гранта N 174140 N304 (польское Министерство науки и высшего образования) с использованием финансирования инфраструктуры CePT ЕС и финансовой поддержки администрации ИПЭН АН РТ.

Благодарим П.А. Косинцева за предоставленный архезоологический материал из Старой Ладоги.

 

Список литературы

Hall T.A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 1999. 41, P. 95–98.

Hofreiter M., Serre D., Poinar HN., Kuch M., Pääbo S. Ancient DNA. Nature. Reviews Genetics 2001. 2: P. 353-358.

Ludwig A., Jenneckens I. A PCR test for mitochondrial heteroplasmy in sturgeon. Animal Genetics. 2000. V. 31, I. 2, P. 153.

Ong T.L., Stabile J., Wirgin I., Waldman J.R. Genetic divergences between Acipenser oxyrinchus oxyrinchus and A. o. desotoi as assessed by mitochondrial DNA sequencing analysis. Copeia, 1996. P. 464-496.

Paabo S., Poinar H., Serre D., Jaenicke-Despres V., Hebler J., Rohland N., Kuch M., Krause J., Vigilant L., Hofreiter M. Genetic analyses from ancient DNA // Annu Rev Genet. 2004. 38: P. 645–679.

Rizzi E., Lari M., Gigli E., De Bellis G., Caramelli D. Ancient DNA studies: new perspectives on old samples. Genetics Selection Evolution 2012, 44: 21 http://www.gsejournal.org/content/44/1/21.

Rozen S., Skaletsky H.J. Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (edKrawetz S, Misener S), 2000. P. 365-386. Humana Press, Totowa, NJ. Source code available at http://fokker.wi.mit.edu/primer3/.

Sambrook J., Fritsch E.F., Maniatis T. Molecular Cloning: A Laboratory Manual, vol. I. 2nd edition. Cold Spring Harbor Laboratory Press, 1989.

Stankovic A. The Past and Future of Sturgeons in Poland: The Genetic Approach // Biology and Conservation of the European Sturgeon Acipenser sturio L. 1758, Springer, 2011. P. 561-572.

Wandeler P., Hoeck PEA, Keller LF. Back to the future: museum specimens in population genetics // Trends in Ecology and Evolution. 2007. 22. P. 634-642.

122

 

 

ПУБЛИКАЦИЯ: Галимова Д.Н., Попович Д., Панагиотополо Х., Аськеев И.В., Аськеев О.В. Предварительные результаты исследования исторической ДНК костных остатков рыб из археологических памятников // Динамика современных экосистем в голоцене: Материалы Третьей Всероссийской научной конференции (с международным участием) / [отв. ред. И.В. Аськеев, Д.В. Иванов]. Казань, 2013. С. 118-122.

 

 

comments powered by HyperComments